assays gibson assembly kit neb e5510s (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
assays gibson assembly kit neb e5510s
Assays Gibson Assembly Kit Neb E5510s, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4041 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/neb+gibson+assembly+kit/Gibson+Assembly+Cloning/pm42030161-567-220-224
Average 99 stars, based on 4041 article reviews
Assays Gibson Assembly Kit Neb E5510s, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 4041 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/neb+gibson+assembly+kit/Gibson+Assembly+Cloning/pm42030161-567-220-224
Average 99 stars, based on 4041 article reviews
assays gibson assembly kit neb e5510s - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: The Yersinia pestis virulence effector YopM binds to a key regulatory site on the human pyrin death domain to inhibit inflammasome activation and effector-triggered immunity Article Snippet: .. All inserts were first PCR amplified then inserted into their respective vectors by either restriction cloning using BamHI and EcoRI sites or using the Article Title: Mitosis Localization Signal (MLS) extends KA1 and regulates MELK kinase localization to plasma membrane and activity in Xenopus embryo. Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Amplification:Article Title: The Yersinia pestis virulence effector YopM binds to a key regulatory site on the human pyrin death domain to inhibit inflammasome activation and effector-triggered immunity Article Snippet: .. All inserts were first PCR amplified then inserted into their respective vectors by either restriction cloning using BamHI and EcoRI sites or using the Article Title: Redox engineering of thermophilic fungus
<i>Myceliophthora thermophila</i>
enhances production of L‑malic acid by consolidated bioprocessing Article Snippet: .. For the construction of the vectors for overexpressing target genes in M. thermophila, the amplicon of sthA (Mycth_2309210) was ligated between the SpeI and BamHI sites of pAN52-PgpdA-bar carrying the bar selectable marker, generating the plasmid PgpdA-sthAbar with the aid of the Article Title: cPLA 2 α targeting to exosomes connects nuclear deformation to LTB 4 -signaling during neutrophil chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a gift from the Zhang laboratory. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Article Title: cPLA 2 α Targeting to Exosomes Connects Nuclear Deformation to LTB 4 -Signaling During Neutrophil Chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a kind gift from the Zhang lab. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Cloning:Article Title: The Yersinia pestis virulence effector YopM binds to a key regulatory site on the human pyrin death domain to inhibit inflammasome activation and effector-triggered immunity Article Snippet: .. All inserts were first PCR amplified then inserted into their respective vectors by either restriction cloning using BamHI and EcoRI sites or using the Marker:Article Title: Redox engineering of thermophilic fungus
<i>Myceliophthora thermophila</i>
enhances production of L‑malic acid by consolidated bioprocessing Article Snippet: .. For the construction of the vectors for overexpressing target genes in M. thermophila, the amplicon of sthA (Mycth_2309210) was ligated between the SpeI and BamHI sites of pAN52-PgpdA-bar carrying the bar selectable marker, generating the plasmid PgpdA-sthAbar with the aid of the Plasmid Preparation:Article Title: Redox engineering of thermophilic fungus
<i>Myceliophthora thermophila</i>
enhances production of L‑malic acid by consolidated bioprocessing Article Snippet: .. For the construction of the vectors for overexpressing target genes in M. thermophila, the amplicon of sthA (Mycth_2309210) was ligated between the SpeI and BamHI sites of pAN52-PgpdA-bar carrying the bar selectable marker, generating the plasmid PgpdA-sthAbar with the aid of the Article Title: cPLA 2 α targeting to exosomes connects nuclear deformation to LTB 4 -signaling during neutrophil chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a gift from the Zhang laboratory. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Article Title: cPLA 2 α Targeting to Exosomes Connects Nuclear Deformation to LTB 4 -Signaling During Neutrophil Chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a kind gift from the Zhang lab. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Article Title: Mitosis Localization Signal (MLS) extends KA1 and regulates MELK kinase localization to plasma membrane and activity in Xenopus embryo. Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Article Title: The Staphylococcus aureus prophage-encoded SSBP attenuates virulence and enhances IL-6-mediated macrophage clearance Article Snippet: The Spot fragment was amplified by PCR using primers #103/#104 and the pSpot2 vector as the template (Chromotek, Planegg, Germany). .. The ssbP plasmid was constructed using the Ligation:Article Title: The hemopexin domain of matrix metalloproteinase-9 attenuates lipopolysaccharide-induced interleukin-6 secretion in liver Article Snippet: .. Ligation was performed with the Article Title: The hemopexin domain of matrix metalloproteinase-9 attenuates lipopolysaccharide-induced interleukin-6 secretion in liver. Article Snippet: .. Ligation was performed with the Clone Assay:Article Title: cPLA 2 α targeting to exosomes connects nuclear deformation to LTB 4 -signaling during neutrophil chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a gift from the Zhang laboratory. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Article Title: cPLA 2 α Targeting to Exosomes Connects Nuclear Deformation to LTB 4 -Signaling During Neutrophil Chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a kind gift from the Zhang lab. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Article Title: Mitosis Localization Signal (MLS) extends KA1 and regulates MELK kinase localization to plasma membrane and activity in Xenopus embryo. Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Construct:Article Title: cPLA 2 α targeting to exosomes connects nuclear deformation to LTB 4 -signaling during neutrophil chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a gift from the Zhang laboratory. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Article Title: cPLA 2 α Targeting to Exosomes Connects Nuclear Deformation to LTB 4 -Signaling During Neutrophil Chemotaxis Article Snippet: .. The cPLA 2 α sgRNA, ACACCACTACCGTAAACTTG, was cloned into the pLentiCRISPR V2 plasmid, which was a kind gift from the Zhang lab. pCDH-puro-GFP-cPLA 2 α construct was cloned using the Article Title: The Staphylococcus aureus prophage-encoded SSBP attenuates virulence and enhances IL-6-mediated macrophage clearance Article Snippet: The Spot fragment was amplified by PCR using primers #103/#104 and the pSpot2 vector as the template (Chromotek, Planegg, Germany). .. The ssbP plasmid was constructed using the |